Prl Protein Cusabio

PRL Antibody

1-CSB-PA006038
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRL. Recognizes PRL from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

Cusabio Laboratories manufactures the prl protein cusabio reagents distributed by Genprice. The Prl Protein Cusabio reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Cusabio. Other Prl products are available in stock. Specificity: Prl Category: Protein Group: Cusabio

PRL Antibody

100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PRL. Recognizes PRL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

Prl Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Prl. Recognizes Prl from Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

PRL Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRL. Recognizes PRL from Horse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

PRL cloning plasmid

10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 684
  • Sequence: atgaacatcaaaggatcgccatggaaagggtccctcctgctgctgctggtgtcaaacctgctcctgtgccagagcgtggcccccttgcccatctgtcccggcggggctgcccgatgccaggtgacccttcgagacctgtttgaccgcgccgtcgtcctgtcccactacatccataa
  • Show more
Description: A cloning plasmid for the PRL gene.

Pig Prolactin (PRL)

  • EUR 679.00
  • EUR 335.00
  • EUR 2172.00
  • EUR 1051.00
  • EUR 1442.00
  • EUR 435.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 25 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Pig Prolactin(PRL) expressed in Yeast

Pig Prolactin (PRL)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 39 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Pig Prolactin(PRL) expressed in E.coli

PRL Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRL. Recognizes PRL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

Cusabio information

Rabbit Prolactin (PRL) ELISA Kit

DLR-PRL-Rb-96T 96T
EUR 661
  • Should the Rabbit Prolactin (PRL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Prolactin (PRL) in samples from serum, plasma or other biological fluids.

Bovine Prolactin (PRL) ELISA Kit

RD-PRL-b-48Tests 48 Tests
EUR 555

Bovine Prolactin (PRL) ELISA Kit

RD-PRL-b-96Tests 96 Tests
EUR 771

Human Prolactin (PRL) ELISA Kit

RD-PRL-Hu-48Tests 48 Tests
EUR 374

Human Prolactin (PRL) ELISA Kit

RD-PRL-Hu-96Tests 96 Tests
EUR 513

Mouse Prolactin (PRL) ELISA Kit

RD-PRL-Mu-48Tests 48 Tests
EUR 489

Mouse Prolactin (PRL) ELISA Kit

RD-PRL-Mu-96Tests 96 Tests
EUR 677

Porcine Prolactin (PRL) ELISA Kit

RD-PRL-p-48Tests 48 Tests
EUR 555

Porcine Prolactin (PRL) ELISA Kit

RD-PRL-p-96Tests 96 Tests
EUR 771

Rat Prolactin (PRL) ELISA Kit

RD-PRL-Ra-48Tests 48 Tests
EUR 511

Rat Prolactin (PRL) ELISA Kit

RD-PRL-Ra-96Tests 96 Tests
EUR 709

Rabbit Prolactin (PRL) ELISA Kit

RD-PRL-Rb-48Tests 48 Tests
EUR 511

Rabbit Prolactin (PRL) ELISA Kit

RD-PRL-Rb-96Tests 96 Tests
EUR 709

Bovine Prolactin (PRL) ELISA Kit

RDR-PRL-b-48Tests 48 Tests
EUR 580

Bovine Prolactin (PRL) ELISA Kit

RDR-PRL-b-96Tests 96 Tests
EUR 807

Human Prolactin (PRL) ELISA Kit

RDR-PRL-Hu-48Tests 48 Tests
EUR 390

Human Prolactin (PRL) ELISA Kit

RDR-PRL-Hu-96Tests 96 Tests
EUR 536