|
1-CSB-PA006038 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against PRL. Recognizes PRL from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
Cusabio Laboratories manufactures the prl protein cusabio reagents distributed by Genprice. The Prl Protein Cusabio reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Cusabio. Other Prl products are available in stock. Specificity: Prl Category: Protein Group: Cusabio
PRL Antibody |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against PRL. Recognizes PRL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
Prl Antibody |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Prl. Recognizes Prl from Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500 |
PRL Antibody |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PRL. Recognizes PRL from Horse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
PRL cloning plasmid |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 684
- Sequence: atgaacatcaaaggatcgccatggaaagggtccctcctgctgctgctggtgtcaaacctgctcctgtgccagagcgtggcccccttgcccatctgtcccggcggggctgcccgatgccaggtgacccttcgagacctgtttgaccgcgccgtcgtcctgtcccactacatccataa
- Show more
|
Description: A cloning plasmid for the PRL gene. |
Pig Prolactin (PRL) |
Cusabio |
-
EUR 679.00
-
EUR 335.00
-
EUR 2172.00
-
EUR 1051.00
-
EUR 1442.00
-
EUR 435.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 25 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Pig Prolactin(PRL) expressed in Yeast |
Pig Prolactin (PRL) |
Cusabio |
-
EUR 611.00
-
EUR 309.00
-
EUR 1827.00
-
EUR 939.00
-
EUR 1218.00
-
EUR 397.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 39 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Pig Prolactin(PRL) expressed in E.coli |
PRL Antibody, HRP conjugated |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PRL. Recognizes PRL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
Cusabio information
Rabbit Prolactin (PRL) ELISA Kit |
DLR-PRL-Rb-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rabbit Prolactin (PRL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Prolactin (PRL) in samples from serum, plasma or other biological fluids. |
Bovine Prolactin (PRL) ELISA Kit |
RD-PRL-b-48Tests |
Reddot Biotech |
48 Tests |
EUR 555 |
Bovine Prolactin (PRL) ELISA Kit |
RD-PRL-b-96Tests |
Reddot Biotech |
96 Tests |
EUR 771 |
Human Prolactin (PRL) ELISA Kit |
RD-PRL-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 374 |
Human Prolactin (PRL) ELISA Kit |
RD-PRL-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 513 |
Mouse Prolactin (PRL) ELISA Kit |
RD-PRL-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Prolactin (PRL) ELISA Kit |
RD-PRL-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Porcine Prolactin (PRL) ELISA Kit |
RD-PRL-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 555 |
Porcine Prolactin (PRL) ELISA Kit |
RD-PRL-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 771 |
Rat Prolactin (PRL) ELISA Kit |
RD-PRL-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rat Prolactin (PRL) ELISA Kit |
RD-PRL-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rabbit Prolactin (PRL) ELISA Kit |
RD-PRL-Rb-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rabbit Prolactin (PRL) ELISA Kit |
RD-PRL-Rb-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Bovine Prolactin (PRL) ELISA Kit |
RDR-PRL-b-48Tests |
Reddot Biotech |
48 Tests |
EUR 580 |
Bovine Prolactin (PRL) ELISA Kit |
RDR-PRL-b-96Tests |
Reddot Biotech |
96 Tests |
EUR 807 |
Human Prolactin (PRL) ELISA Kit |
RDR-PRL-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 390 |
Human Prolactin (PRL) ELISA Kit |
RDR-PRL-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 536 |