PRL Antibody
1-CSB-PA006038	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRL. Recognizes PRL from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

Cusabio Laboratories manufactures the prl protein cusabio reagents distributed by Genprice. The Prl Protein Cusabio reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Cusabio. Other Prl products are available in stock. Specificity: Prl Category: Protein Group: Cusabio

PRL Antibody
Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PRL. Recognizes PRL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

Prl Antibody
Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Prl. Recognizes Prl from Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

PRL Antibody
Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRL. Recognizes PRL from Horse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

PRL cloning plasmid
Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 684 Sequence: atgaacatcaaaggatcgccatggaaagggtccctcctgctgctgctggtgtcaaacctgctcctgtgccagagcgtggcccccttgcccatctgtcccggcggggctgcccgatgccaggtgacccttcgagacctgtttgaccgcgccgtcgtcctgtcccactacatccataa Show more
Description: A cloning plasmid for the PRL gene.

Pig Prolactin (PRL)
Cusabio	EUR 679.00 EUR 335.00 EUR 2172.00 EUR 1051.00 EUR 1442.00 EUR 435.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 25 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Pig Prolactin(PRL) expressed in Yeast

Pig Prolactin (PRL)
Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 39 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Pig Prolactin(PRL) expressed in E.coli

PRL Antibody, HRP conjugated
Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRL. Recognizes PRL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

Cusabio information

Rabbit Prolactin (PRL) ELISA Kit
DLR-PRL-Rb-96T	DL Develop	96T	EUR 661
Should the Rabbit Prolactin (PRL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Prolactin (PRL) in samples from serum, plasma or other biological fluids.

Bovine Prolactin (PRL) ELISA Kit
RD-PRL-b-48Tests	Reddot Biotech	48 Tests	EUR 555

Bovine Prolactin (PRL) ELISA Kit
RD-PRL-b-96Tests	Reddot Biotech	96 Tests	EUR 771

Human Prolactin (PRL) ELISA Kit
RD-PRL-Hu-48Tests	Reddot Biotech	48 Tests	EUR 374

Human Prolactin (PRL) ELISA Kit
RD-PRL-Hu-96Tests	Reddot Biotech	96 Tests	EUR 513

Mouse Prolactin (PRL) ELISA Kit
RD-PRL-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Prolactin (PRL) ELISA Kit
RD-PRL-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Porcine Prolactin (PRL) ELISA Kit
RD-PRL-p-48Tests	Reddot Biotech	48 Tests	EUR 555

Porcine Prolactin (PRL) ELISA Kit
RD-PRL-p-96Tests	Reddot Biotech	96 Tests	EUR 771

Rat Prolactin (PRL) ELISA Kit
RD-PRL-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Prolactin (PRL) ELISA Kit
RD-PRL-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Rabbit Prolactin (PRL) ELISA Kit
RD-PRL-Rb-48Tests	Reddot Biotech	48 Tests	EUR 511

Rabbit Prolactin (PRL) ELISA Kit
RD-PRL-Rb-96Tests	Reddot Biotech	96 Tests	EUR 709

Bovine Prolactin (PRL) ELISA Kit
RDR-PRL-b-48Tests	Reddot Biotech	48 Tests	EUR 580

Bovine Prolactin (PRL) ELISA Kit
RDR-PRL-b-96Tests	Reddot Biotech	96 Tests	EUR 807

Human Prolactin (PRL) ELISA Kit
RDR-PRL-Hu-48Tests	Reddot Biotech	48 Tests	EUR 390

Human Prolactin (PRL) ELISA Kit
RDR-PRL-Hu-96Tests	Reddot Biotech	96 Tests	EUR 536