Invent Biotechnologies Cs-031

Lab Reagents

Human IgG antibody Laboratories manufactures the invent biotechnologies cs-031 reagents distributed by Genprice. The Invent Biotechnologies Cs-031 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Invent Biotechnologies Inc.. Other Invent products are available in stock. Specificity: Invent Category: Biotechnologies Group: Cs-031

Cs-031 information

CS 2100

B5636-10 10 mg
EUR 438

CS 2100

B5636-50 50 mg
EUR 1639

CS siRNA

20-abx901306
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CS siRNA

20-abx912991
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CS siRNA

20-abx912992
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Recombinant ASFV Ken-031 Protein (aa 1-319)

VAng-0808Lsx-1mg 1 mg
EUR 4504
Description: African swine fever virus (isolate Pig/Kenya/KEN-50/1950) Protein MGF 360-8L (Ken-031), recombinant protein from E. coli. (Uniprot ID: P0C9N7)

Recombinant ASFV Ken-031 Protein (aa 1-319)

VAng-0808Lsx-500g 500 µg
EUR 2993
Description: African swine fever virus (isolate Pig/Kenya/KEN-50/1950) Protein MGF 360-8L (Ken-031), recombinant protein from E. coli. (Uniprot ID: P0C9N7)

Recombinant ASFV Ken-031 Protein (aa 1-319)

VAng-0808Lsx-50g 50 µg
EUR 2044
Description: African swine fever virus (isolate Pig/Kenya/KEN-50/1950) Protein MGF 360-8L (Ken-031), recombinant protein from E. coli. (Uniprot ID: P0C9N7)

Recombinant ASFV War-031 Protein (aa 1-353)

VAng-0996Lsx-1mg 1 mg
EUR 4724
Description: African swine fever virus (isolate Warthog/Namibia/Wart80/1980) Protein MGF 360-11L (War-031), recombinant protein from E. coli. (Uniprot ID: P0C9P6)

Recombinant ASFV War-031 Protein (aa 1-353)

VAng-0996Lsx-500g 500 µg
EUR 3143
Description: African swine fever virus (isolate Warthog/Namibia/Wart80/1980) Protein MGF 360-11L (War-031), recombinant protein from E. coli. (Uniprot ID: P0C9P6)

Recombinant ASFV War-031 Protein (aa 1-353)

VAng-0996Lsx-50g 50 µg
EUR 2154
Description: African swine fever virus (isolate Warthog/Namibia/Wart80/1980) Protein MGF 360-11L (War-031), recombinant protein from E. coli. (Uniprot ID: P0C9P6)

Recombinant ASFV Pret-031 Protein (aa 1-352)

VAng-2323Lsx-1mg 1 mg
EUR 4724
Description: African swine fever virus (isolate Tick/South Africa/Pretoriuskop Pr4/1996) Protein MGF 360-9L (Pret-031), recombinant protein from E. coli. (Uniprot ID: P0C9P2)

Recombinant ASFV Pret-031 Protein (aa 1-352)

VAng-2323Lsx-500g 500 µg
EUR 3143
Description: African swine fever virus (isolate Tick/South Africa/Pretoriuskop Pr4/1996) Protein MGF 360-9L (Pret-031), recombinant protein from E. coli. (Uniprot ID: P0C9P2)

Recombinant ASFV Pret-031 Protein (aa 1-352)

VAng-2323Lsx-50g 50 µg
EUR 2140
Description: African swine fever virus (isolate Tick/South Africa/Pretoriuskop Pr4/1996) Protein MGF 360-9L (Pret-031), recombinant protein from E. coli. (Uniprot ID: P0C9P2)

CS Conjugated Antibody

C43035 100ul
EUR 397

CS Conjugated Antibody

C32989 100ul
EUR 397

CS cloning plasmid

CSB-CL006031HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1203
  • Sequence: atgatgtatggtggcatgagaggcatgaagggattggtctatgaaacatcagttcttgatcctgatgagggcatccgtttccgaggctttagtatccctgaatgccagaaactgctacccaaggctaagggtggggaagaacccctgcctgagggcttattttggctgctggtaa
  • Show more
Description: A cloning plasmid for the CS gene.