Lab Reagents
Human IgG antibody Laboratories manufactures the invent biotechnologies cs-031 reagents distributed by Genprice. The Invent Biotechnologies Cs-031 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Invent Biotechnologies Inc.. Other Invent products are available in stock. Specificity: Invent Category: Biotechnologies Group: Cs-031
Cs-031 information
CS 2100 |
|
B5636-10 |
ApexBio |
10 mg |
EUR 438 |
CS 2100 |
|
B5636-50 |
ApexBio |
50 mg |
EUR 1639 |
CS siRNA |
|
20-abx901306 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CS siRNA |
|
20-abx912991 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CS siRNA |
|
20-abx912992 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant ASFV Ken-031 Protein (aa 1-319) |
|
VAng-0808Lsx-1mg |
Creative Biolabs |
1 mg |
EUR 4504 |
|
Description: African swine fever virus (isolate Pig/Kenya/KEN-50/1950) Protein MGF 360-8L (Ken-031), recombinant protein from E. coli. (Uniprot ID: P0C9N7) |
Recombinant ASFV Ken-031 Protein (aa 1-319) |
|
VAng-0808Lsx-500g |
Creative Biolabs |
500 µg |
EUR 2993 |
|
Description: African swine fever virus (isolate Pig/Kenya/KEN-50/1950) Protein MGF 360-8L (Ken-031), recombinant protein from E. coli. (Uniprot ID: P0C9N7) |
Recombinant ASFV Ken-031 Protein (aa 1-319) |
|
VAng-0808Lsx-50g |
Creative Biolabs |
50 µg |
EUR 2044 |
|
Description: African swine fever virus (isolate Pig/Kenya/KEN-50/1950) Protein MGF 360-8L (Ken-031), recombinant protein from E. coli. (Uniprot ID: P0C9N7) |
Recombinant ASFV War-031 Protein (aa 1-353) |
|
VAng-0996Lsx-1mg |
Creative Biolabs |
1 mg |
EUR 4724 |
|
Description: African swine fever virus (isolate Warthog/Namibia/Wart80/1980) Protein MGF 360-11L (War-031), recombinant protein from E. coli. (Uniprot ID: P0C9P6) |
Recombinant ASFV War-031 Protein (aa 1-353) |
|
VAng-0996Lsx-500g |
Creative Biolabs |
500 µg |
EUR 3143 |
|
Description: African swine fever virus (isolate Warthog/Namibia/Wart80/1980) Protein MGF 360-11L (War-031), recombinant protein from E. coli. (Uniprot ID: P0C9P6) |
Recombinant ASFV War-031 Protein (aa 1-353) |
|
VAng-0996Lsx-50g |
Creative Biolabs |
50 µg |
EUR 2154 |
|
Description: African swine fever virus (isolate Warthog/Namibia/Wart80/1980) Protein MGF 360-11L (War-031), recombinant protein from E. coli. (Uniprot ID: P0C9P6) |
Recombinant ASFV Pret-031 Protein (aa 1-352) |
|
VAng-2323Lsx-1mg |
Creative Biolabs |
1 mg |
EUR 4724 |
|
Description: African swine fever virus (isolate Tick/South Africa/Pretoriuskop Pr4/1996) Protein MGF 360-9L (Pret-031), recombinant protein from E. coli. (Uniprot ID: P0C9P2) |
Recombinant ASFV Pret-031 Protein (aa 1-352) |
|
VAng-2323Lsx-500g |
Creative Biolabs |
500 µg |
EUR 3143 |
|
Description: African swine fever virus (isolate Tick/South Africa/Pretoriuskop Pr4/1996) Protein MGF 360-9L (Pret-031), recombinant protein from E. coli. (Uniprot ID: P0C9P2) |
Recombinant ASFV Pret-031 Protein (aa 1-352) |
|
VAng-2323Lsx-50g |
Creative Biolabs |
50 µg |
EUR 2140 |
|
Description: African swine fever virus (isolate Tick/South Africa/Pretoriuskop Pr4/1996) Protein MGF 360-9L (Pret-031), recombinant protein from E. coli. (Uniprot ID: P0C9P2) |
CS Conjugated Antibody |
|
C43035 |
SAB |
100ul |
EUR 397 |
CS Conjugated Antibody |
|
C32989 |
SAB |
100ul |
EUR 397 |
CS cloning plasmid |
|
CSB-CL006031HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1203
- Sequence: atgatgtatggtggcatgagaggcatgaagggattggtctatgaaacatcagttcttgatcctgatgagggcatccgtttccgaggctttagtatccctgaatgccagaaactgctacccaaggctaagggtggggaagaacccctgcctgagggcttattttggctgctggtaa
- Show more
|
|
Description: A cloning plasmid for the CS gene. |
